ID: 1123493475

View in Genome Browser
Species Human (GRCh38)
Location 15:20800373-20800395
Sequence ATTCCAGGCCGCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123493475_1123493479 -10 Left 1123493475 15:20800373-20800395 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1123493479 15:20800386-20800408 GGCCTGGAATATGGCACTGCAGG No data
1123493475_1123493481 13 Left 1123493475 15:20800373-20800395 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1123493481 15:20800409-20800431 ACCCCCGCCCTGCTGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123493475 Original CRISPR ATTCCAGGCCGCTGCGGAGT GGG (reversed) Intergenic
No off target data available for this crispr