ID: 1123493586

View in Genome Browser
Species Human (GRCh38)
Location 15:20800789-20800811
Sequence GTCCTCCCGTGCCATAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123493586_1123493587 -3 Left 1123493586 15:20800789-20800811 CCTACACTATGGCACGGGAGGAC No data
Right 1123493587 15:20800809-20800831 GACCCAGCCTCACTGAGCTCTGG No data
1123493586_1123493591 10 Left 1123493586 15:20800789-20800811 CCTACACTATGGCACGGGAGGAC No data
Right 1123493591 15:20800822-20800844 TGAGCTCTGGACTCCAGCACCGG No data
1123493586_1123493595 28 Left 1123493586 15:20800789-20800811 CCTACACTATGGCACGGGAGGAC No data
Right 1123493595 15:20800840-20800862 ACCGGAGGACACCTACACGGAGG No data
1123493586_1123493592 13 Left 1123493586 15:20800789-20800811 CCTACACTATGGCACGGGAGGAC No data
Right 1123493592 15:20800825-20800847 GCTCTGGACTCCAGCACCGGAGG No data
1123493586_1123493594 25 Left 1123493586 15:20800789-20800811 CCTACACTATGGCACGGGAGGAC No data
Right 1123493594 15:20800837-20800859 AGCACCGGAGGACACCTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123493586 Original CRISPR GTCCTCCCGTGCCATAGTGT AGG (reversed) Intergenic
No off target data available for this crispr