ID: 1123501228

View in Genome Browser
Species Human (GRCh38)
Location 15:20882848-20882870
Sequence ATGGACAAAAGTGCCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123501228_1123501233 6 Left 1123501228 15:20882848-20882870 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123501233 15:20882877-20882899 CTGCAAAAGTATTGTAGCTGTGG No data
1123501228_1123501234 7 Left 1123501228 15:20882848-20882870 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123501234 15:20882878-20882900 TGCAAAAGTATTGTAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123501228 Original CRISPR ATGGACAAAAGTGCCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr