ID: 1123505761

View in Genome Browser
Species Human (GRCh38)
Location 15:20940777-20940799
Sequence TATCCAGGGCTGCCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123505753_1123505761 10 Left 1123505753 15:20940744-20940766 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123505761 15:20940777-20940799 TATCCAGGGCTGCCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123505761 Original CRISPR TATCCAGGGCTGCCCGCGGC GGG Intergenic
No off target data available for this crispr