ID: 1123506284

View in Genome Browser
Species Human (GRCh38)
Location 15:20942944-20942966
Sequence TAGGGTGGGTAGGAAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123506267_1123506284 23 Left 1123506267 15:20942898-20942920 CCGGGAAGAGGGAGTAGGAGAGC No data
Right 1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG No data
1123506265_1123506284 30 Left 1123506265 15:20942891-20942913 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG No data
1123506275_1123506284 -7 Left 1123506275 15:20942928-20942950 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123506284 Original CRISPR TAGGGTGGGTAGGAAGCTTC GGG Intergenic
No off target data available for this crispr