ID: 1123507459

View in Genome Browser
Species Human (GRCh38)
Location 15:20958681-20958703
Sequence CTCAATCCTGGGACCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123507459_1123507470 24 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507470 15:20958728-20958750 TCTGGAAGGGATAAGTAATGAGG No data
1123507459_1123507468 11 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507468 15:20958715-20958737 CAGAGCCTCAGACTCTGGAAGGG No data
1123507459_1123507466 6 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507466 15:20958710-20958732 AGAGACAGAGCCTCAGACTCTGG No data
1123507459_1123507471 29 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507471 15:20958733-20958755 AAGGGATAAGTAATGAGGAATGG No data
1123507459_1123507472 30 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507472 15:20958734-20958756 AGGGATAAGTAATGAGGAATGGG No data
1123507459_1123507467 10 Left 1123507459 15:20958681-20958703 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123507467 15:20958714-20958736 ACAGAGCCTCAGACTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123507459 Original CRISPR CTCAATCCTGGGACCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr