ID: 1123511865

View in Genome Browser
Species Human (GRCh38)
Location 15:21009456-21009478
Sequence CATGGTGAGCAGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123511855_1123511865 20 Left 1123511855 15:21009413-21009435 CCTTATATTTATGGTAAAAGGCA No data
Right 1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123511865 Original CRISPR CATGGTGAGCAGGGGGAAGA AGG Intergenic
No off target data available for this crispr