ID: 1123512599

View in Genome Browser
Species Human (GRCh38)
Location 15:21012610-21012632
Sequence CCGGACCTGGCAGTAGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123512599_1123512618 29 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512618 15:21012662-21012684 AGGAGGTAGCAGGGCACCGAGGG No data
1123512599_1123512610 -2 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512610 15:21012631-21012653 GGGGAAACTCGGGATGTCCAGGG No data
1123512599_1123512614 19 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512614 15:21012652-21012674 GGCTGACCTGAGGAGGTAGCAGG No data
1123512599_1123512611 9 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512611 15:21012642-21012664 GGATGTCCAGGGCTGACCTGAGG No data
1123512599_1123512609 -3 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512609 15:21012630-21012652 CGGGGAAACTCGGGATGTCCAGG No data
1123512599_1123512617 28 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512617 15:21012661-21012683 GAGGAGGTAGCAGGGCACCGAGG No data
1123512599_1123512612 12 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512612 15:21012645-21012667 TGTCCAGGGCTGACCTGAGGAGG No data
1123512599_1123512615 20 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512615 15:21012653-21012675 GCTGACCTGAGGAGGTAGCAGGG No data
1123512599_1123512619 30 Left 1123512599 15:21012610-21012632 CCCAAACCTACTGCCAGGTCCGG No data
Right 1123512619 15:21012663-21012685 GGAGGTAGCAGGGCACCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123512599 Original CRISPR CCGGACCTGGCAGTAGGTTT GGG (reversed) Intergenic
No off target data available for this crispr