ID: 1123513482

View in Genome Browser
Species Human (GRCh38)
Location 15:21017047-21017069
Sequence GGCTCCTCCTGGTACTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123513482_1123513487 -3 Left 1123513482 15:21017047-21017069 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123513487 15:21017067-21017089 GCCTGAAGGGAGCTCCATGGAGG No data
1123513482_1123513493 27 Left 1123513482 15:21017047-21017069 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123513493 15:21017097-21017119 TCGGATGACACCCCTATTTTAGG No data
1123513482_1123513486 -6 Left 1123513482 15:21017047-21017069 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123513486 15:21017064-21017086 GGAGCCTGAAGGGAGCTCCATGG No data
1123513482_1123513489 8 Left 1123513482 15:21017047-21017069 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123513489 15:21017078-21017100 GCTCCATGGAGGACCTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123513482 Original CRISPR GGCTCCTCCTGGTACTCACT AGG (reversed) Intergenic
No off target data available for this crispr