ID: 1123513487

View in Genome Browser
Species Human (GRCh38)
Location 15:21017067-21017089
Sequence GCCTGAAGGGAGCTCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123513479_1123513487 15 Left 1123513479 15:21017029-21017051 CCATATCTGGGACTGAGGCCTAG No data
Right 1123513487 15:21017067-21017089 GCCTGAAGGGAGCTCCATGGAGG No data
1123513478_1123513487 16 Left 1123513478 15:21017028-21017050 CCCATATCTGGGACTGAGGCCTA No data
Right 1123513487 15:21017067-21017089 GCCTGAAGGGAGCTCCATGGAGG No data
1123513482_1123513487 -3 Left 1123513482 15:21017047-21017069 CCTAGTGAGTACCAGGAGGAGCC No data
Right 1123513487 15:21017067-21017089 GCCTGAAGGGAGCTCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123513487 Original CRISPR GCCTGAAGGGAGCTCCATGG AGG Intergenic
No off target data available for this crispr