ID: 1123515230

View in Genome Browser
Species Human (GRCh38)
Location 15:21025917-21025939
Sequence GGGCCAAGGTCTAGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123515219_1123515230 30 Left 1123515219 15:21025864-21025886 CCCAGTGGCTTAAACACCACACA No data
Right 1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG No data
1123515220_1123515230 29 Left 1123515220 15:21025865-21025887 CCAGTGGCTTAAACACCACACAT No data
Right 1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG No data
1123515226_1123515230 -7 Left 1123515226 15:21025901-21025923 CCAGATGAATCCTACAGGGCCAA No data
Right 1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG No data
1123515223_1123515230 1 Left 1123515223 15:21025893-21025915 CCACAGGTCCAGATGAATCCTAC No data
Right 1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG No data
1123515222_1123515230 14 Left 1123515222 15:21025880-21025902 CCACACATTTATACCACAGGTCC No data
Right 1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123515230 Original CRISPR GGGCCAAGGTCTAGGTGTGC TGG Intergenic
No off target data available for this crispr