ID: 1123515906

View in Genome Browser
Species Human (GRCh38)
Location 15:21029661-21029683
Sequence GAGGCATGCAAGATTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123515906_1123515910 6 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515910 15:21029690-21029712 CTGTCCAAAGCACGTAAGGGAGG No data
1123515906_1123515908 2 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515908 15:21029686-21029708 ACTTCTGTCCAAAGCACGTAAGG No data
1123515906_1123515909 3 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515909 15:21029687-21029709 CTTCTGTCCAAAGCACGTAAGGG No data
1123515906_1123515912 23 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515912 15:21029707-21029729 GGGAGGAGCTCAGTGCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123515906 Original CRISPR GAGGCATGCAAGATTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr