ID: 1123515908

View in Genome Browser
Species Human (GRCh38)
Location 15:21029686-21029708
Sequence ACTTCTGTCCAAAGCACGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123515906_1123515908 2 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515908 15:21029686-21029708 ACTTCTGTCCAAAGCACGTAAGG No data
1123515904_1123515908 17 Left 1123515904 15:21029646-21029668 CCCACAGGTGGACTTCCTGCAGC No data
Right 1123515908 15:21029686-21029708 ACTTCTGTCCAAAGCACGTAAGG No data
1123515903_1123515908 18 Left 1123515903 15:21029645-21029667 CCCCACAGGTGGACTTCCTGCAG No data
Right 1123515908 15:21029686-21029708 ACTTCTGTCCAAAGCACGTAAGG No data
1123515905_1123515908 16 Left 1123515905 15:21029647-21029669 CCACAGGTGGACTTCCTGCAGCA No data
Right 1123515908 15:21029686-21029708 ACTTCTGTCCAAAGCACGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123515908 Original CRISPR ACTTCTGTCCAAAGCACGTA AGG Intergenic
No off target data available for this crispr