ID: 1123515912

View in Genome Browser
Species Human (GRCh38)
Location 15:21029707-21029729
Sequence GGGAGGAGCTCAGTGCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123515911_1123515912 -10 Left 1123515911 15:21029694-21029716 CCAAAGCACGTAAGGGAGGAGCT No data
Right 1123515912 15:21029707-21029729 GGGAGGAGCTCAGTGCGCACAGG No data
1123515907_1123515912 4 Left 1123515907 15:21029680-21029702 CCTCACACTTCTGTCCAAAGCAC No data
Right 1123515912 15:21029707-21029729 GGGAGGAGCTCAGTGCGCACAGG No data
1123515906_1123515912 23 Left 1123515906 15:21029661-21029683 CCTGCAGCAATCTTGCATGCCTC No data
Right 1123515912 15:21029707-21029729 GGGAGGAGCTCAGTGCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123515912 Original CRISPR GGGAGGAGCTCAGTGCGCAC AGG Intergenic
No off target data available for this crispr