ID: 1123515933

View in Genome Browser
Species Human (GRCh38)
Location 15:21029842-21029864
Sequence GCCTACACCTCCACCATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123515933_1123515936 26 Left 1123515933 15:21029842-21029864 CCATCTATGGTGGAGGTGTAGGC No data
Right 1123515936 15:21029891-21029913 CATTGAACACAACAACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123515933 Original CRISPR GCCTACACCTCCACCATAGA TGG (reversed) Intergenic
No off target data available for this crispr