ID: 1123516627

View in Genome Browser
Species Human (GRCh38)
Location 15:21035400-21035422
Sequence GCATTTACAGGTGTGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123516615_1123516627 15 Left 1123516615 15:21035362-21035384 CCTCAAGCCACCCTCCCACCTTG 0: 4
1: 89
2: 1045
3: 4337
4: 16323
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516614_1123516627 20 Left 1123516614 15:21035357-21035379 CCTGGCCTCAAGCCACCCTCCCA 0: 8
1: 338
2: 4606
3: 23551
4: 61050
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516619_1123516627 4 Left 1123516619 15:21035373-21035395 CCTCCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516612_1123516627 29 Left 1123516612 15:21035348-21035370 CCTCAACCTCCTGGCCTCAAGCC 0: 11
1: 293
2: 3682
3: 15343
4: 51496
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516617_1123516627 8 Left 1123516617 15:21035369-21035391 CCACCCTCCCACCTTGGCCTCCC 0: 8
1: 220
2: 803
3: 3084
4: 8657
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516620_1123516627 1 Left 1123516620 15:21035376-21035398 CCCACCTTGGCCTCCCAAAGTGT 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516613_1123516627 23 Left 1123516613 15:21035354-21035376 CCTCCTGGCCTCAAGCCACCCTC No data
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516622_1123516627 -3 Left 1123516622 15:21035380-21035402 CCTTGGCCTCCCAAAGTGTTGCA 0: 22
1: 727
2: 13851
3: 116827
4: 236335
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516618_1123516627 5 Left 1123516618 15:21035372-21035394 CCCTCCCACCTTGGCCTCCCAAA 0: 167
1: 1142
2: 3246
3: 6046
4: 7232
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516623_1123516627 -9 Left 1123516623 15:21035386-21035408 CCTCCCAAAGTGTTGCATTTACA No data
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data
1123516621_1123516627 0 Left 1123516621 15:21035377-21035399 CCACCTTGGCCTCCCAAAGTGTT 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
Right 1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123516627 Original CRISPR GCATTTACAGGTGTGTGCCA AGG Intergenic
No off target data available for this crispr