ID: 1123531975

View in Genome Browser
Species Human (GRCh38)
Location 15:21151717-21151739
Sequence GGCTGCACTCCTTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123531958_1123531975 24 Left 1123531958 15:21151670-21151692 CCACAGCACGCAGCTCCCCACTC No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data
1123531964_1123531975 7 Left 1123531964 15:21151687-21151709 CCACTCCACAGGAACCATTGGGC No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data
1123531962_1123531975 8 Left 1123531962 15:21151686-21151708 CCCACTCCACAGGAACCATTGGG No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data
1123531969_1123531975 -7 Left 1123531969 15:21151701-21151723 CCATTGGGCCCACTGGGGCTGCA No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data
1123531965_1123531975 2 Left 1123531965 15:21151692-21151714 CCACAGGAACCATTGGGCCCACT No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data
1123531960_1123531975 9 Left 1123531960 15:21151685-21151707 CCCCACTCCACAGGAACCATTGG No data
Right 1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123531975 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG Intergenic
No off target data available for this crispr