ID: 1123536381 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:21188563-21188585 |
| Sequence | ATGAACGCCTCCTCGGGGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123536381_1123536387 | 11 | Left | 1123536381 | 15:21188563-21188585 | CCCATCCCCGAGGAGGCGTTCAT | No data | ||
| Right | 1123536387 | 15:21188597-21188619 | CTATCTCTCCATCGTTCCTATGG | No data | ||||
| 1123536381_1123536388 | 12 | Left | 1123536381 | 15:21188563-21188585 | CCCATCCCCGAGGAGGCGTTCAT | No data | ||
| Right | 1123536388 | 15:21188598-21188620 | TATCTCTCCATCGTTCCTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123536381 | Original CRISPR | ATGAACGCCTCCTCGGGGAT GGG (reversed) | Intergenic | ||