ID: 1123536381

View in Genome Browser
Species Human (GRCh38)
Location 15:21188563-21188585
Sequence ATGAACGCCTCCTCGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123536381_1123536387 11 Left 1123536381 15:21188563-21188585 CCCATCCCCGAGGAGGCGTTCAT No data
Right 1123536387 15:21188597-21188619 CTATCTCTCCATCGTTCCTATGG No data
1123536381_1123536388 12 Left 1123536381 15:21188563-21188585 CCCATCCCCGAGGAGGCGTTCAT No data
Right 1123536388 15:21188598-21188620 TATCTCTCCATCGTTCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123536381 Original CRISPR ATGAACGCCTCCTCGGGGAT GGG (reversed) Intergenic