ID: 1123536440

View in Genome Browser
Species Human (GRCh38)
Location 15:21189169-21189191
Sequence AGCAACTTGAAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123536440_1123536444 21 Left 1123536440 15:21189169-21189191 CCCTCACCAGGCTTCAAGTTGCT No data
Right 1123536444 15:21189213-21189235 AAATAATTTCAAATATGTTCTGG No data
1123536440_1123536445 30 Left 1123536440 15:21189169-21189191 CCCTCACCAGGCTTCAAGTTGCT No data
Right 1123536445 15:21189222-21189244 CAAATATGTTCTGGAGATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123536440 Original CRISPR AGCAACTTGAAGCCTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr