ID: 1123537595

View in Genome Browser
Species Human (GRCh38)
Location 15:21251360-21251382
Sequence CTAGCTCTTCCAGTTTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123537593_1123537595 17 Left 1123537593 15:21251320-21251342 CCCGAAAGGAATCTGAAGTTATT No data
Right 1123537595 15:21251360-21251382 CTAGCTCTTCCAGTTTCAATAGG No data
1123537594_1123537595 16 Left 1123537594 15:21251321-21251343 CCGAAAGGAATCTGAAGTTATTC No data
Right 1123537595 15:21251360-21251382 CTAGCTCTTCCAGTTTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123537595 Original CRISPR CTAGCTCTTCCAGTTTCAAT AGG Intergenic
No off target data available for this crispr