ID: 1123539052

View in Genome Browser
Species Human (GRCh38)
Location 15:21269235-21269257
Sequence CTTTGTAAGGCCCAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123539045_1123539052 16 Left 1123539045 15:21269196-21269218 CCTGGCTGGACGCAGCGGCTCAC No data
Right 1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG No data
1123539046_1123539052 -8 Left 1123539046 15:21269220-21269242 CCTATAATCCCAGCACTTTGTAA No data
Right 1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123539052 Original CRISPR CTTTGTAAGGCCCAGGTGGA TGG Intergenic
No off target data available for this crispr