ID: 1123543404

View in Genome Browser
Species Human (GRCh38)
Location 15:21318150-21318172
Sequence AATACTAATATGCTGCTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123543401_1123543404 24 Left 1123543401 15:21318103-21318125 CCAACAAGCTAAAGATGACAAAT 0: 4
1: 0
2: 2
3: 29
4: 261
Right 1123543404 15:21318150-21318172 AATACTAATATGCTGCTGACGGG No data
1123543400_1123543404 25 Left 1123543400 15:21318102-21318124 CCCAACAAGCTAAAGATGACAAA 0: 4
1: 0
2: 1
3: 23
4: 331
Right 1123543404 15:21318150-21318172 AATACTAATATGCTGCTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123543404 Original CRISPR AATACTAATATGCTGCTGAC GGG Intergenic
No off target data available for this crispr