ID: 1123543660

View in Genome Browser
Species Human (GRCh38)
Location 15:21320800-21320822
Sequence GAGTCGTGGGAGAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123543660_1123543666 -6 Left 1123543660 15:21320800-21320822 CCTACCACCTTCTCCCACGACTC No data
Right 1123543666 15:21320817-21320839 CGACTCCAACATAAGAAAATGGG No data
1123543660_1123543665 -7 Left 1123543660 15:21320800-21320822 CCTACCACCTTCTCCCACGACTC No data
Right 1123543665 15:21320816-21320838 ACGACTCCAACATAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123543660 Original CRISPR GAGTCGTGGGAGAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr