ID: 1123544232

View in Genome Browser
Species Human (GRCh38)
Location 15:21325235-21325257
Sequence CCGCCCCCTTTCCCGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123544232_1123544249 19 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544249 15:21325277-21325299 GGTCTCCGCCTGTTGGACGGGGG No data
1123544232_1123544251 23 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544251 15:21325281-21325303 TCCGCCTGTTGGACGGGGGCGGG No data
1123544232_1123544253 24 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544253 15:21325282-21325304 CCGCCTGTTGGACGGGGGCGGGG No data
1123544232_1123544255 29 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544255 15:21325287-21325309 TGTTGGACGGGGGCGGGGCCTGG No data
1123544232_1123544248 18 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544248 15:21325276-21325298 GGGTCTCCGCCTGTTGGACGGGG No data
1123544232_1123544246 16 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544246 15:21325274-21325296 GCGGGTCTCCGCCTGTTGGACGG No data
1123544232_1123544242 -3 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544242 15:21325255-21325277 CGGGTCTCCGGGAAAGGGGGCGG No data
1123544232_1123544239 -8 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544239 15:21325250-21325272 GGGGGCGGGTCTCCGGGAAAGGG No data
1123544232_1123544247 17 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data
1123544232_1123544240 -7 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544240 15:21325251-21325273 GGGGCGGGTCTCCGGGAAAGGGG No data
1123544232_1123544238 -9 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544238 15:21325249-21325271 AGGGGGCGGGTCTCCGGGAAAGG No data
1123544232_1123544250 22 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544250 15:21325280-21325302 CTCCGCCTGTTGGACGGGGGCGG No data
1123544232_1123544243 -2 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544243 15:21325256-21325278 GGGTCTCCGGGAAAGGGGGCGGG No data
1123544232_1123544241 -6 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544241 15:21325252-21325274 GGGCGGGTCTCCGGGAAAGGGGG No data
1123544232_1123544245 12 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544245 15:21325270-21325292 GGGGGCGGGTCTCCGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123544232 Original CRISPR CCGCCCCCTTTCCCGGACAC CGG (reversed) Intergenic