ID: 1123544235

View in Genome Browser
Species Human (GRCh38)
Location 15:21325242-21325264
Sequence CGGAGACCCGCCCCCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123544235_1123544255 22 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544255 15:21325287-21325309 TGTTGGACGGGGGCGGGGCCTGG No data
1123544235_1123544246 9 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544246 15:21325274-21325296 GCGGGTCTCCGCCTGTTGGACGG No data
1123544235_1123544242 -10 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544242 15:21325255-21325277 CGGGTCTCCGGGAAAGGGGGCGG No data
1123544235_1123544256 27 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544256 15:21325292-21325314 GACGGGGGCGGGGCCTGGACAGG No data
1123544235_1123544251 16 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544251 15:21325281-21325303 TCCGCCTGTTGGACGGGGGCGGG No data
1123544235_1123544250 15 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544250 15:21325280-21325302 CTCCGCCTGTTGGACGGGGGCGG No data
1123544235_1123544243 -9 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544243 15:21325256-21325278 GGGTCTCCGGGAAAGGGGGCGGG No data
1123544235_1123544245 5 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544245 15:21325270-21325292 GGGGGCGGGTCTCCGCCTGTTGG No data
1123544235_1123544247 10 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data
1123544235_1123544248 11 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544248 15:21325276-21325298 GGGTCTCCGCCTGTTGGACGGGG No data
1123544235_1123544249 12 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544249 15:21325277-21325299 GGTCTCCGCCTGTTGGACGGGGG No data
1123544235_1123544257 30 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544257 15:21325295-21325317 GGGGGCGGGGCCTGGACAGGTGG No data
1123544235_1123544253 17 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544253 15:21325282-21325304 CCGCCTGTTGGACGGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123544235 Original CRISPR CGGAGACCCGCCCCCTTTCC CGG (reversed) Intergenic