ID: 1123544244

View in Genome Browser
Species Human (GRCh38)
Location 15:21325262-21325284
Sequence CGGAGACCCGCCCCCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123544244_1123544259 22 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544259 15:21325307-21325329 TGGACAGGTGGTCACGCCCCAGG No data
1123544244_1123544260 29 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544260 15:21325314-21325336 GTGGTCACGCCCCAGGAGATAGG No data
1123544244_1123544255 2 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544255 15:21325287-21325309 TGTTGGACGGGGGCGGGGCCTGG No data
1123544244_1123544249 -8 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544249 15:21325277-21325299 GGTCTCCGCCTGTTGGACGGGGG No data
1123544244_1123544250 -5 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544250 15:21325280-21325302 CTCCGCCTGTTGGACGGGGGCGG No data
1123544244_1123544253 -3 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544253 15:21325282-21325304 CCGCCTGTTGGACGGGGGCGGGG No data
1123544244_1123544248 -9 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544248 15:21325276-21325298 GGGTCTCCGCCTGTTGGACGGGG No data
1123544244_1123544256 7 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544256 15:21325292-21325314 GACGGGGGCGGGGCCTGGACAGG No data
1123544244_1123544257 10 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544257 15:21325295-21325317 GGGGGCGGGGCCTGGACAGGTGG No data
1123544244_1123544247 -10 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data
1123544244_1123544251 -4 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544251 15:21325281-21325303 TCCGCCTGTTGGACGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123544244 Original CRISPR CGGAGACCCGCCCCCTTTCC CGG (reversed) Intergenic