ID: 1123544247

View in Genome Browser
Species Human (GRCh38)
Location 15:21325275-21325297
Sequence CGGGTCTCCGCCTGTTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123544232_1123544247 17 Left 1123544232 15:21325235-21325257 CCGGTGTCCGGGAAAGGGGGCGG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data
1123544235_1123544247 10 Left 1123544235 15:21325242-21325264 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data
1123544244_1123544247 -10 Left 1123544244 15:21325262-21325284 CCGGGAAAGGGGGCGGGTCTCCG No data
Right 1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123544247 Original CRISPR CGGGTCTCCGCCTGTTGGAC GGG Intergenic
No off target data available for this crispr