ID: 1123544930

View in Genome Browser
Species Human (GRCh38)
Location 15:21330710-21330732
Sequence GGTGGTGGTTGTTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123544930_1123544939 13 Left 1123544930 15:21330710-21330732 CCCTTTGCTGAACAACCACCACC No data
Right 1123544939 15:21330746-21330768 CCCCACACCCTTGGTTCTGCAGG No data
1123544930_1123544936 4 Left 1123544930 15:21330710-21330732 CCCTTTGCTGAACAACCACCACC No data
Right 1123544936 15:21330737-21330759 TTCTAGGACCCCCACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123544930 Original CRISPR GGTGGTGGTTGTTCAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr