ID: 1123548567

View in Genome Browser
Species Human (GRCh38)
Location 15:21357794-21357816
Sequence AGCCCTCCTCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123548560_1123548567 4 Left 1123548560 15:21357767-21357789 CCTGATATTCTCTGTGATAGAGG No data
Right 1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123548567 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG Intergenic
No off target data available for this crispr