ID: 1123549983

View in Genome Browser
Species Human (GRCh38)
Location 15:21369475-21369497
Sequence ATTCCAGGCCGCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123549983_1123549987 -10 Left 1123549983 15:21369475-21369497 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1123549987 15:21369488-21369510 GGCCTGGAATATGGCACTGCAGG No data
1123549983_1123549989 13 Left 1123549983 15:21369475-21369497 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1123549989 15:21369511-21369533 ACCCCCGCCCTGCTGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123549983 Original CRISPR ATTCCAGGCCGCTGCGGAGT GGG (reversed) Intergenic
No off target data available for this crispr