ID: 1123550085

View in Genome Browser
Species Human (GRCh38)
Location 15:21369876-21369898
Sequence AGTGTAGGGCATGGCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550085_1123550100 28 Left 1123550085 15:21369876-21369898 CCTGTCCCGCCATGCCCTACACT No data
Right 1123550100 15:21369927-21369949 GCTCTGGACTCCAGCACCGGAGG No data
1123550085_1123550095 12 Left 1123550085 15:21369876-21369898 CCTGTCCCGCCATGCCCTACACT No data
Right 1123550095 15:21369911-21369933 GACCCAGCCTCACTGAGCTCTGG No data
1123550085_1123550092 -10 Left 1123550085 15:21369876-21369898 CCTGTCCCGCCATGCCCTACACT No data
Right 1123550092 15:21369889-21369911 GCCCTACACTATGGCACGGGAGG No data
1123550085_1123550099 25 Left 1123550085 15:21369876-21369898 CCTGTCCCGCCATGCCCTACACT No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550085 Original CRISPR AGTGTAGGGCATGGCGGGAC AGG (reversed) Intergenic
No off target data available for this crispr