ID: 1123550087

View in Genome Browser
Species Human (GRCh38)
Location 15:21369881-21369903
Sequence GCCATAGTGTAGGGCATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550087_1123550095 7 Left 1123550087 15:21369881-21369903 CCCGCCATGCCCTACACTATGGC No data
Right 1123550095 15:21369911-21369933 GACCCAGCCTCACTGAGCTCTGG No data
1123550087_1123550099 20 Left 1123550087 15:21369881-21369903 CCCGCCATGCCCTACACTATGGC No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550087_1123550100 23 Left 1123550087 15:21369881-21369903 CCCGCCATGCCCTACACTATGGC No data
Right 1123550100 15:21369927-21369949 GCTCTGGACTCCAGCACCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550087 Original CRISPR GCCATAGTGTAGGGCATGGC GGG (reversed) Intergenic
No off target data available for this crispr