ID: 1123550088

View in Genome Browser
Species Human (GRCh38)
Location 15:21369882-21369904
Sequence TGCCATAGTGTAGGGCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550088_1123550095 6 Left 1123550088 15:21369882-21369904 CCGCCATGCCCTACACTATGGCA No data
Right 1123550095 15:21369911-21369933 GACCCAGCCTCACTGAGCTCTGG No data
1123550088_1123550100 22 Left 1123550088 15:21369882-21369904 CCGCCATGCCCTACACTATGGCA No data
Right 1123550100 15:21369927-21369949 GCTCTGGACTCCAGCACCGGAGG No data
1123550088_1123550099 19 Left 1123550088 15:21369882-21369904 CCGCCATGCCCTACACTATGGCA No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550088 Original CRISPR TGCCATAGTGTAGGGCATGG CGG (reversed) Intergenic
No off target data available for this crispr