ID: 1123550093

View in Genome Browser
Species Human (GRCh38)
Location 15:21369890-21369912
Sequence TCCTCCCGTGCCATAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550093_1123550102 26 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data
1123550093_1123550099 11 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550093_1123550100 14 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550100 15:21369927-21369949 GCTCTGGACTCCAGCACCGGAGG No data
1123550093_1123550103 29 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550103 15:21369942-21369964 ACCGGAGGACACCTACACGGAGG No data
1123550093_1123550095 -2 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550095 15:21369911-21369933 GACCCAGCCTCACTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550093 Original CRISPR TCCTCCCGTGCCATAGTGTA GGG (reversed) Intergenic
No off target data available for this crispr