ID: 1123550099

View in Genome Browser
Species Human (GRCh38)
Location 15:21369924-21369946
Sequence TGAGCTCTGGACTCCAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550085_1123550099 25 Left 1123550085 15:21369876-21369898 CCTGTCCCGCCATGCCCTACACT No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550084_1123550099 26 Left 1123550084 15:21369875-21369897 CCCTGTCCCGCCATGCCCTACAC No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550093_1123550099 11 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550088_1123550099 19 Left 1123550088 15:21369882-21369904 CCGCCATGCCCTACACTATGGCA No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550094_1123550099 10 Left 1123550094 15:21369891-21369913 CCTACACTATGGCACGGGAGGAC No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550089_1123550099 16 Left 1123550089 15:21369885-21369907 CCATGCCCTACACTATGGCACGG No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data
1123550087_1123550099 20 Left 1123550087 15:21369881-21369903 CCCGCCATGCCCTACACTATGGC No data
Right 1123550099 15:21369924-21369946 TGAGCTCTGGACTCCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550099 Original CRISPR TGAGCTCTGGACTCCAGCAC CGG Intergenic
No off target data available for this crispr