ID: 1123550102

View in Genome Browser
Species Human (GRCh38)
Location 15:21369939-21369961
Sequence AGCACCGGAGGACACCTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123550096_1123550102 3 Left 1123550096 15:21369913-21369935 CCCAGCCTCACTGAGCTCTGGAC No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data
1123550097_1123550102 2 Left 1123550097 15:21369914-21369936 CCAGCCTCACTGAGCTCTGGACT No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data
1123550093_1123550102 26 Left 1123550093 15:21369890-21369912 CCCTACACTATGGCACGGGAGGA No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data
1123550098_1123550102 -2 Left 1123550098 15:21369918-21369940 CCTCACTGAGCTCTGGACTCCAG No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data
1123550094_1123550102 25 Left 1123550094 15:21369891-21369913 CCTACACTATGGCACGGGAGGAC No data
Right 1123550102 15:21369939-21369961 AGCACCGGAGGACACCTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123550102 Original CRISPR AGCACCGGAGGACACCTACA CGG Intergenic
No off target data available for this crispr