ID: 1123554523

View in Genome Browser
Species Human (GRCh38)
Location 15:21414585-21414607
Sequence TAAGCTGCTCACATTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 11, 2: 3, 3: 5, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123554523 Original CRISPR TAAGCTGCTCACATTGATAT TGG (reversed) Intronic
912330064 1:108811937-108811959 TACCCTGATCACACTGATATCGG + Intergenic
913491488 1:119383906-119383928 TAAACTAGTCACATTCATATAGG - Intronic
918227451 1:182497168-182497190 GAAGCAGTTCACATTGATGTAGG - Intronic
1064181357 10:13118801-13118823 TAAGCTGGTCCCAGTTATATTGG + Intronic
1064548549 10:16475507-16475529 GAAGCTGCTTCCAATGATATGGG + Intronic
1068981810 10:63070567-63070589 TACCCTTCTCACATTGACATGGG + Intergenic
1073221673 10:101879677-101879699 TGAGCTGCACACTTTTATATGGG - Intronic
1073939821 10:108683648-108683670 TAAGCATCTCACAATGAGATAGG + Intergenic
1079533690 11:21485630-21485652 TAAGCTGCTCCCACTGAGAGTGG + Intronic
1079606035 11:22367606-22367628 TAGGCTGATCACATTAATTTGGG - Intronic
1081177905 11:39951466-39951488 TAATCTGCTCACAGTGCTGTGGG - Intergenic
1081885254 11:46489937-46489959 TCAGCCTCTCACAGTGATATTGG + Intronic
1091640322 12:2231092-2231114 GCAGGTGCTCACATGGATATGGG - Intronic
1100948128 12:99811303-99811325 TAACCTACTTGCATTGATATTGG + Intronic
1104166858 12:126240031-126240053 TAATCAGCTGACATTGAGATGGG - Intergenic
1104266006 12:127233026-127233048 TGTGTGGCTCACATTGATATAGG + Intergenic
1107312573 13:39094947-39094969 TAAGCTGCTCCCACTGAGTTGGG + Intergenic
1111119554 13:83828509-83828531 TAAGATGCTAACATTCATTTTGG + Intergenic
1112838525 13:103546887-103546909 TTATCTGCTGACCTTGATATGGG + Intergenic
1112843311 13:103606572-103606594 TAAGCTGCTCTACTTGAGATAGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1116604162 14:46968264-46968286 TAAGCTGCTCCCACTGACAGTGG + Intronic
1117168134 14:53060376-53060398 TAAGGAACTTACATTGATATAGG - Intronic
1117326439 14:54673230-54673252 TGTGCTGCTCCCATTGAAATTGG - Intronic
1119446974 14:74673167-74673189 TAAGCTGCTCACACTGGTGGTGG - Exonic
1121182478 14:91939838-91939860 TAAGCAGCTGACCTTGAGATGGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1132078766 15:98846777-98846799 TAAGCTGTTAACATTAATCTTGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133898639 16:9952419-9952441 TAAGCTGCTCACATTCCCAGTGG - Intronic
1137860995 16:51846728-51846750 TAAAGTACTCACATTAATATAGG + Intergenic
1139821644 16:69726044-69726066 TAAGTTGCTAACATTAAAATGGG - Intronic
1141116301 16:81312959-81312981 TCAGCTGCTCACAGGGATACTGG + Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1151864608 17:76792694-76792716 TAATCAGCTCACCTTGAGATGGG + Intergenic
1154151820 18:11912163-11912185 TAAGATGCTGACATTTATAAAGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155324120 18:24648990-24649012 AAAGCAGTTCACATTCATATGGG - Intergenic
1160457248 18:79010623-79010645 TAAGTTGCTCACAGTTTTATTGG + Intergenic
1166740074 19:45109313-45109335 CAAGCTGTTCACACTGAGATGGG - Intronic
1167423865 19:49419541-49419563 TAAGCTCCTCAGCTTGATGTTGG - Intergenic
925361625 2:3284190-3284212 TAAGCTGGGCACATGGAGATGGG + Intronic
925361642 2:3284259-3284281 TAAGCTGGGCACATGGAGATGGG + Intronic
925361659 2:3284328-3284350 TAAGCTGGGCACATGGAGATGGG + Intronic
925361676 2:3284397-3284419 TAAGCTGGGCACATGGAGATGGG + Intronic
925361693 2:3284466-3284488 TAAGCTGGGCACATGGAGATGGG + Intronic
925794491 2:7527579-7527601 TGAGTTGCTCACATCAATATGGG + Intergenic
927298481 2:21483290-21483312 TCAGCTGCTCACATGGAGAATGG - Intergenic
928285032 2:29982725-29982747 TAACCAGCTGACATTGAGATGGG + Intergenic
930555169 2:52886166-52886188 TAAGCTATTTACATTAATATTGG - Intergenic
937505566 2:122532733-122532755 TTAGCTGCACAAATTGTTATTGG - Intergenic
937799658 2:126068045-126068067 CAACCTGCTCACAATGTTATTGG - Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938333673 2:130469394-130469416 CAGGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939582792 2:143970290-143970312 AATCCTGCTCACATTGGTATTGG - Intronic
939774449 2:146367203-146367225 TTAGCTGCTAACATTGTTAATGG - Intergenic
940566845 2:155375396-155375418 TATGCTCCTAACATTGTTATTGG + Intergenic
942031385 2:171964650-171964672 TCAGCTGATAACATTGATAGAGG + Intronic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
942826338 2:180181397-180181419 TAAGCTGCAAACATTGCAATGGG - Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
947869055 2:233422380-233422402 TGAGCTGCTCATTTTGCTATGGG - Intronic
1175660332 20:60807233-60807255 TAAGCTGCTGACGTTGACCTTGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178635095 21:34295411-34295433 TAAGTTACTCACATTGGTATTGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181890769 22:26061556-26061578 TCTGCTGCTCACAGTGAGATGGG + Intergenic
1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG + Intronic
949223777 3:1669053-1669075 TAAGCTGGTCAGATTCATCTGGG + Intergenic
955913666 3:63884349-63884371 TTAGCTGCTCAAATTGTTCTAGG - Intronic
958065071 3:88534268-88534290 TAAGCAGCTCACATTAATCTGGG - Intergenic
959633603 3:108536547-108536569 AAAGGTGCTAACATTGATAATGG + Intergenic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
967633652 3:191776416-191776438 TATGATGGTCACATGGATATAGG - Intergenic
968607936 4:1544357-1544379 TGAGCTGCACACATTGACCTAGG - Intergenic
970141123 4:12983261-12983283 TAATCTGCTGACCTTGAGATAGG - Intergenic
974300526 4:60060105-60060127 TACACTGCTCACATTCATATGGG + Intergenic
977429187 4:96909792-96909814 TAATCTGCTCTCATTTTTATGGG - Intergenic
977851405 4:101834288-101834310 TCATCTGCCCACATTGATTTTGG + Intronic
978748209 4:112219139-112219161 TAAGCTGCTCATATTTAAAGTGG - Intergenic
979612623 4:122705155-122705177 TTGGCTGCTCACAATGATTTGGG - Intergenic
982741569 4:159062165-159062187 TTAGCTGCTCACAGTGGAATCGG - Intergenic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
983962299 4:173769521-173769543 TAAGATGTTCGCACTGATATTGG - Intergenic
985361380 4:189179292-189179314 TAAACAGCTCACATTGATTGAGG + Intergenic
995313126 5:110736032-110736054 TAAGCTGCCCAATTTGTTATGGG + Intronic
997192525 5:131951240-131951262 TACGATGGTCACATTCATATTGG - Exonic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1002220952 5:177681250-177681272 TAAGGTCCACACATTGATACTGG - Intergenic
1005275387 6:24211511-24211533 TAAGCAGCTGACCTTGAGATGGG + Intronic
1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG + Intronic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1021561930 7:21976821-21976843 TAAGCTTCACACCTTGCTATTGG + Intergenic
1022870243 7:34471013-34471035 TTATATCCTCACATTGATATCGG + Intergenic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028185764 7:87784362-87784384 TAAACTGCTCACATTTGGATGGG + Intronic
1028441433 7:90867005-90867027 TAAGTTGCTCATGTTGCTATTGG + Intronic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1031219178 7:118942366-118942388 TTAGATGCTTACATTGAAATAGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040725223 8:50374705-50374727 TGAGCAGTTCACATTGATTTGGG - Intronic
1043096520 8:75982170-75982192 TAAGATGATAACATTGATAAGGG - Intergenic
1050301276 9:4261256-4261278 AGAGCTGCTCACATTGAATTGGG - Intronic
1050716077 9:8527645-8527667 TAAGCTGTTTACTTTGACATTGG - Intronic
1052709493 9:32035990-32036012 TAGGGTTCTCTCATTGATATGGG - Intergenic
1055226929 9:74008339-74008361 TAGGCTGCTTTCATTGAAATAGG - Intergenic
1055933083 9:81579901-81579923 AAAGCTGAGAACATTGATATGGG - Intergenic
1058817041 9:108694004-108694026 TAAGCAGCTAACATTCATACAGG - Intergenic
1058895723 9:109399040-109399062 CAAACTGCTCCCATTGATGTAGG + Intronic
1062138108 9:134940315-134940337 TAAGGGGCCCACATTGAAATAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1188816004 X:34715091-34715113 TAAGCTCCAGACATTGATATTGG + Intergenic
1191616417 X:63174700-63174722 TAAGCTGCTGGCACTGATAAGGG - Intergenic
1191619880 X:63204223-63204245 TAAGCTGCTGGCACTGATAAGGG + Intergenic
1194505410 X:94728326-94728348 TAAACTGCCCACAGTGAAATAGG + Intergenic
1194859751 X:98982875-98982897 TAATCTGATTAGATTGATATTGG + Intergenic
1197066889 X:122244351-122244373 TAAGATGCACACATTGACAATGG - Intergenic
1198510439 X:137345270-137345292 TAATCTGCTCAGTTTGGTATTGG + Intergenic
1198656766 X:138923241-138923263 TAAGGTACTCACAGTGAGATGGG + Intronic
1198805372 X:140488928-140488950 TAAGCATCTCAAACTGATATTGG + Intergenic
1200411257 Y:2864160-2864182 TAAGATGCTCAGATTGAGTTGGG + Intronic