ID: 1123557867

View in Genome Browser
Species Human (GRCh38)
Location 15:21451774-21451796
Sequence TGGAGGCGAGCCATAGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123557867_1123557879 27 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557879 15:21451824-21451846 GTGCGCCCGGCGGGACAGTGAGG No data
1123557867_1123557872 -6 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557872 15:21451791-21451813 CCTCCACCGGCCGGCACGCAAGG No data
1123557867_1123557877 17 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557867_1123557878 18 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557878 15:21451815-21451837 GAGCTCTGCGTGCGCCCGGCGGG No data
1123557867_1123557876 14 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557876 15:21451811-21451833 AGGTGAGCTCTGCGTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123557867 Original CRISPR TGGAGGCGAGCCATAGGTGA CGG (reversed) Intergenic
No off target data available for this crispr