ID: 1123557869

View in Genome Browser
Species Human (GRCh38)
Location 15:21451780-21451802
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123557869_1123557882 28 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557882 15:21451831-21451853 CGGCGGGACAGTGAGGTAAAAGG No data
1123557869_1123557878 12 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557878 15:21451815-21451837 GAGCTCTGCGTGCGCCCGGCGGG No data
1123557869_1123557876 8 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557876 15:21451811-21451833 AGGTGAGCTCTGCGTGCGCCCGG No data
1123557869_1123557883 29 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557883 15:21451832-21451854 GGCGGGACAGTGAGGTAAAAGGG No data
1123557869_1123557879 21 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557879 15:21451824-21451846 GTGCGCCCGGCGGGACAGTGAGG No data
1123557869_1123557877 11 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123557869 Original CRISPR GGCCGGTGGAGGCGAGCCAT AGG (reversed) Intergenic
No off target data available for this crispr