ID: 1123557873

View in Genome Browser
Species Human (GRCh38)
Location 15:21451794-21451816
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123557873_1123557883 15 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557883 15:21451832-21451854 GGCGGGACAGTGAGGTAAAAGGG No data
1123557873_1123557877 -3 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557873_1123557884 18 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557884 15:21451835-21451857 GGGACAGTGAGGTAAAAGGGCGG No data
1123557873_1123557879 7 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557879 15:21451824-21451846 GTGCGCCCGGCGGGACAGTGAGG No data
1123557873_1123557885 19 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557885 15:21451836-21451858 GGACAGTGAGGTAAAAGGGCGGG No data
1123557873_1123557886 26 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557886 15:21451843-21451865 GAGGTAAAAGGGCGGGAGCGCGG No data
1123557873_1123557887 27 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557887 15:21451844-21451866 AGGTAAAAGGGCGGGAGCGCGGG No data
1123557873_1123557882 14 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557882 15:21451831-21451853 CGGCGGGACAGTGAGGTAAAAGG No data
1123557873_1123557878 -2 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557878 15:21451815-21451837 GAGCTCTGCGTGCGCCCGGCGGG No data
1123557873_1123557876 -6 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557876 15:21451811-21451833 AGGTGAGCTCTGCGTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123557873 Original CRISPR TCACCTTGCGTGCCGGCCGG TGG (reversed) Intergenic
No off target data available for this crispr