ID: 1123557877

View in Genome Browser
Species Human (GRCh38)
Location 15:21451814-21451836
Sequence TGAGCTCTGCGTGCGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123557871_1123557877 0 Left 1123557871 15:21451791-21451813 CCTCCACCGGCCGGCACGCAAGG No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557873_1123557877 -3 Left 1123557873 15:21451794-21451816 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557875_1123557877 -10 Left 1123557875 15:21451801-21451823 CCGGCACGCAAGGTGAGCTCTGC No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557874_1123557877 -6 Left 1123557874 15:21451797-21451819 CCGGCCGGCACGCAAGGTGAGCT No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557869_1123557877 11 Left 1123557869 15:21451780-21451802 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data
1123557867_1123557877 17 Left 1123557867 15:21451774-21451796 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123557877 Original CRISPR TGAGCTCTGCGTGCGCCCGG CGG Intergenic
No off target data available for this crispr