ID: 1123558480

View in Genome Browser
Species Human (GRCh38)
Location 15:21456553-21456575
Sequence ATGGACAAAAGTGCCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123558480_1123558486 7 Left 1123558480 15:21456553-21456575 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558480_1123558485 6 Left 1123558480 15:21456553-21456575 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123558485 15:21456582-21456604 CTGCAAAAGTATTGTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123558480 Original CRISPR ATGGACAAAAGTGCCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr