ID: 1123558486

View in Genome Browser
Species Human (GRCh38)
Location 15:21456583-21456605
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123558475_1123558486 27 Left 1123558475 15:21456533-21456555 CCCTCTCTAATCCCAAAGCTCCC No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558480_1123558486 7 Left 1123558480 15:21456553-21456575 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558479_1123558486 15 Left 1123558479 15:21456545-21456567 CCAAAGCTCCCATAAAGGCACTT No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558478_1123558486 16 Left 1123558478 15:21456544-21456566 CCCAAAGCTCCCATAAAGGCACT No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558476_1123558486 26 Left 1123558476 15:21456534-21456556 CCTCTCTAATCCCAAAGCTCCCA No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data
1123558481_1123558486 6 Left 1123558481 15:21456554-21456576 CCATAAAGGCACTTTTGTCCATG No data
Right 1123558486 15:21456583-21456605 TGCAAAAGTATTGTAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123558486 Original CRISPR TGCAAAAGTATTGTAGCTGT GGG Intergenic
No off target data available for this crispr