ID: 1123558587

View in Genome Browser
Species Human (GRCh38)
Location 15:21458159-21458181
Sequence TAGCTAAAGGAATTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123558587_1123558590 8 Left 1123558587 15:21458159-21458181 CCAGCACCAAATTCCTTTAGCTA No data
Right 1123558590 15:21458190-21458212 TCACAATGTATTCCAAAATCAGG No data
1123558587_1123558591 11 Left 1123558587 15:21458159-21458181 CCAGCACCAAATTCCTTTAGCTA No data
Right 1123558591 15:21458193-21458215 CAATGTATTCCAAAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123558587 Original CRISPR TAGCTAAAGGAATTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr