ID: 1123558591

View in Genome Browser
Species Human (GRCh38)
Location 15:21458193-21458215
Sequence CAATGTATTCCAAAATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123558588_1123558591 5 Left 1123558588 15:21458165-21458187 CCAAATTCCTTTAGCTACTGTAG No data
Right 1123558591 15:21458193-21458215 CAATGTATTCCAAAATCAGGAGG No data
1123558589_1123558591 -2 Left 1123558589 15:21458172-21458194 CCTTTAGCTACTGTAGCTTCACA No data
Right 1123558591 15:21458193-21458215 CAATGTATTCCAAAATCAGGAGG No data
1123558587_1123558591 11 Left 1123558587 15:21458159-21458181 CCAGCACCAAATTCCTTTAGCTA No data
Right 1123558591 15:21458193-21458215 CAATGTATTCCAAAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123558591 Original CRISPR CAATGTATTCCAAAATCAGG AGG Intergenic
No off target data available for this crispr