ID: 1123562987

View in Genome Browser
Species Human (GRCh38)
Location 15:21514450-21514472
Sequence CCCATTGCCTTTCTACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123562987_1123563001 21 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123563001 15:21514494-21514516 GCCCGCGGCGGGGGCTGGTTGGG No data
1123562987_1123562991 -5 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562991 15:21514468-21514490 ATGGGGTAGGTAAGCTATCCAGG No data
1123562987_1123563000 20 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123563000 15:21514493-21514515 TGCCCGCGGCGGGGGCTGGTTGG No data
1123562987_1123562993 6 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562993 15:21514479-21514501 AAGCTATCCAGGGCTGCCCGCGG No data
1123562987_1123562994 9 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562994 15:21514482-21514504 CTATCCAGGGCTGCCCGCGGCGG No data
1123562987_1123562999 16 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562999 15:21514489-21514511 GGGCTGCCCGCGGCGGGGGCTGG No data
1123562987_1123562995 10 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562995 15:21514483-21514505 TATCCAGGGCTGCCCGCGGCGGG No data
1123562987_1123562996 11 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562996 15:21514484-21514506 ATCCAGGGCTGCCCGCGGCGGGG No data
1123562987_1123562997 12 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562997 15:21514485-21514507 TCCAGGGCTGCCCGCGGCGGGGG No data
1123562987_1123562992 -4 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562992 15:21514469-21514491 TGGGGTAGGTAAGCTATCCAGGG No data
1123562987_1123563003 22 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123563003 15:21514495-21514517 CCCGCGGCGGGGGCTGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123562987 Original CRISPR CCCATTGCCTTTCTACACTC TGG (reversed) Intergenic
No off target data available for this crispr