ID: 1123562995

View in Genome Browser
Species Human (GRCh38)
Location 15:21514483-21514505
Sequence TATCCAGGGCTGCCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123562987_1123562995 10 Left 1123562987 15:21514450-21514472 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1123562995 15:21514483-21514505 TATCCAGGGCTGCCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123562995 Original CRISPR TATCCAGGGCTGCCCGCGGC GGG Intergenic
No off target data available for this crispr