ID: 1123563491

View in Genome Browser
Species Human (GRCh38)
Location 15:21516595-21516617
Sequence TACTCCCTCTTCCCGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123563491_1123563502 15 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563502 15:21516633-21516655 CTGCCCGGCCAGGCCTAGGGTGG No data
1123563491_1123563497 0 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563497 15:21516618-21516640 GGAGCGCTGCGGGGCCTGCCCGG No data
1123563491_1123563496 -9 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563496 15:21516609-21516631 GAGGGAGTAGGAGCGCTGCGGGG No data
1123563491_1123563509 29 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563509 15:21516647-21516669 CTAGGGTGGGTAGGAAGCTTCGG No data
1123563491_1123563506 20 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563506 15:21516638-21516660 CGGCCAGGCCTAGGGTGGGTAGG No data
1123563491_1123563495 -10 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563495 15:21516608-21516630 AGAGGGAGTAGGAGCGCTGCGGG No data
1123563491_1123563503 16 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563503 15:21516634-21516656 TGCCCGGCCAGGCCTAGGGTGGG No data
1123563491_1123563498 5 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563498 15:21516623-21516645 GCTGCGGGGCCTGCCCGGCCAGG No data
1123563491_1123563500 12 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563500 15:21516630-21516652 GGCCTGCCCGGCCAGGCCTAGGG No data
1123563491_1123563510 30 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data
1123563491_1123563499 11 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563499 15:21516629-21516651 GGGCCTGCCCGGCCAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123563491 Original CRISPR TACTCCCTCTTCCCGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr