ID: 1123563493

View in Genome Browser
Species Human (GRCh38)
Location 15:21516602-21516624
Sequence GCGCTCCTACTCCCTCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123563493_1123563500 5 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563500 15:21516630-21516652 GGCCTGCCCGGCCAGGCCTAGGG No data
1123563493_1123563497 -7 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563497 15:21516618-21516640 GGAGCGCTGCGGGGCCTGCCCGG No data
1123563493_1123563503 9 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563503 15:21516634-21516656 TGCCCGGCCAGGCCTAGGGTGGG No data
1123563493_1123563509 22 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563509 15:21516647-21516669 CTAGGGTGGGTAGGAAGCTTCGG No data
1123563493_1123563510 23 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data
1123563493_1123563506 13 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563506 15:21516638-21516660 CGGCCAGGCCTAGGGTGGGTAGG No data
1123563493_1123563498 -2 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563498 15:21516623-21516645 GCTGCGGGGCCTGCCCGGCCAGG No data
1123563493_1123563502 8 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563502 15:21516633-21516655 CTGCCCGGCCAGGCCTAGGGTGG No data
1123563493_1123563499 4 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563499 15:21516629-21516651 GGGCCTGCCCGGCCAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123563493 Original CRISPR GCGCTCCTACTCCCTCTTCC CGG (reversed) Intergenic
No off target data available for this crispr