ID: 1123563501

View in Genome Browser
Species Human (GRCh38)
Location 15:21516632-21516654
Sequence CACCCTAGGCCTGGCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123563501_1123563511 7 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563511 15:21516662-21516684 AGCTTCGGGTGCTGTACCACAGG No data
1123563501_1123563517 28 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563517 15:21516683-21516705 GGCCTCGGTGGAAGTGGTGGAGG No data
1123563501_1123563509 -8 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563509 15:21516647-21516669 CTAGGGTGGGTAGGAAGCTTCGG No data
1123563501_1123563513 16 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563513 15:21516671-21516693 TGCTGTACCACAGGCCTCGGTGG No data
1123563501_1123563510 -7 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data
1123563501_1123563512 13 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563512 15:21516668-21516690 GGGTGCTGTACCACAGGCCTCGG No data
1123563501_1123563514 22 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563514 15:21516677-21516699 ACCACAGGCCTCGGTGGAAGTGG No data
1123563501_1123563516 25 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563516 15:21516680-21516702 ACAGGCCTCGGTGGAAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123563501 Original CRISPR CACCCTAGGCCTGGCCGGGC AGG (reversed) Intergenic
No off target data available for this crispr